Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107487
Name   oriT_RF-1|unnamed in_silico
Organism   Salmonella enterica subsp. enterica serovar Choleraesuis
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_005862 (1906..1965 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_RF-1|unnamed
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7922 GenBank   NC_005862
Plasmid name   RF-1|unnamed Incompatibility group   ColRNAI
Plasmid size   6066 bp Coordinate of oriT [Strand]   1906..1965 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Choleraesuis

Cargo genes


Drug resistance gene   sul2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -