Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107474
Name   oriT1_E-1|unnamed in_silico
Organism   Staphylococcus aureus
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_010077 (20597..20836 [-], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 37..42, 45..50  (TTTTTT..AAAAAA)
 36..41, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT1_E-1|unnamed
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7909 GenBank   NC_010077
Plasmid name   E-1|unnamed Incompatibility group   -
Plasmid size   34986 bp Coordinate of oriT [Strand]   20597..20836 [-]; 1255..1489 [+]
Host baterium   Staphylococcus aureus

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsR, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21