Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107427 |
| Name | oriT_pLB925A01  |
| Organism | Levilactobacillus brevis |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_012548 (36..73 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pLB925A01
ACACCATCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCATCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7862 | GenBank | NC_012548 |
| Plasmid name | pLB925A01 | Incompatibility group | - |
| Plasmid size | 1815 bp | Coordinate of oriT [Strand] | 36..73 [+] |
| Host baterium | Levilactobacillus brevis |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |