Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107380 |
| Name | oriT_pIL2 |
| Organism | Lactococcus lactis subsp. lactis |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_017489 (5394..5429 [-], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 1..7, 17..23 (ACCCCAC..GTGGGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_pIL2
ACCCCACAATTATTTGGTGGGGTGTAAGTGCGCATT
ACCCCACAATTATTTGGTGGGGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7817 | GenBank | NC_017489 |
| Plasmid name | pIL2 | Incompatibility group | - |
| Plasmid size | 8277 bp | Coordinate of oriT [Strand] | 5394..5429 [-] |
| Host baterium | Lactococcus lactis subsp. lactis |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |