Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107379
Name   oriT_pVF18 in_silico
Organism   Lactococcus lactis subsp. lactis bv. diacetylactis
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_015900 (9234..9370 [+], 137 nt)
oriT length   137 nt
IRs (inverted repeats)      21..28, 42..49  (AAAAGGGG..CCCCTTTT)
 25..30, 39..44  (GGGGAA..TTCCCC)
Location of nic site      104..105
Conserved sequence flanking the
  nic site  
 
 GCTTGCAGTA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 137 nt

>oriT_pVF18
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTAATTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTTCTATTTTGTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7816 GenBank   NC_015900
Plasmid name   pVF18 Incompatibility group   -
Plasmid size   18977 bp Coordinate of oriT [Strand]   9234..9370 [+]
Host baterium   Lactococcus lactis subsp. lactis bv. diacetylactis

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -