Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107373 |
| Name | oriT_pRC18  |
| Organism | Latilactobacillus curvatus |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_003320 (2413..2450 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pRC18
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7810 | GenBank | NC_003320 |
| Plasmid name | pRC18 | Incompatibility group | - |
| Plasmid size | 18664 bp | Coordinate of oriT [Strand] | 2413..2450 [+] |
| Host baterium | Latilactobacillus curvatus |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |