Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107363 |
| Name | oriT_pLG9  |
| Organism | Lactococcus garvieae strain IPLA 31405 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_KM007159 (4600..4736 [+], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | 21..28, 42..49 (AAAAGGGG..CCCCTTTT) 25..30, 39..44 (GGGGAA..TTCCCC) |
| Location of nic site | 104..105 |
| Conserved sequence flanking the nic site |
GCTTGCAGTA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT_pLG9
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTTCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTTCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7800 | GenBank | NZ_KM007159 |
| Plasmid name | pLG9 | Incompatibility group | - |
| Plasmid size | 9124 bp | Coordinate of oriT [Strand] | 4600..4736 [+] |
| Host baterium | Lactococcus garvieae strain IPLA 31405 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |