Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107345 |
| Name | oriT_RB2-047|unnamed2  |
| Organism | Acinetobacter johnsonii strain RB2-047 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JADDYQ010000116 (1207..1242 [-], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_RB2-047|unnamed2
CACGGCTAACTGAAAGTTTGCATAAGTGCGCCATTA
CACGGCTAACTGAAAGTTTGCATAAGTGCGCCATTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7781 | GenBank | NZ_JADDYQ010000116 |
| Plasmid name | RB2-047|unnamed2 | Incompatibility group | - |
| Plasmid size | 2267 bp | Coordinate of oriT [Strand] | 1207..1242 [-] |
| Host baterium | Acinetobacter johnsonii strain RB2-047 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |