Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 107317
• Name: oriT_pCR2
• Organism: Corynebacterium renale
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_EF488047 (1165..1224 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pCR2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATGCTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 7753
• GenBank: NZ_EF488047
• Plasmid name: pCR2
• Incompatibility group: ColRNAI
• Plasmid size: 3195 bp
• Coordinate of oriT [Strand]: 1165..1224 [+]
• Host baterium: Corynebacterium renale

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -