Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107218 |
| Name | oriT_pRUM  |
| Organism | Enterococcus faecium |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_005000 (18549..18649 [+], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_pRUM
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGACTTTCGTTAAGAAAAAGGCACAAGGCAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGACTTTCGTTAAGAAAAAGGCACAAGGCAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7654 | GenBank | NC_005000 |
| Plasmid name | pRUM | Incompatibility group | - |
| Plasmid size | 24873 bp | Coordinate of oriT [Strand] | 18549..18649 [+] |
| Host baterium | Enterococcus faecium |
Cargo genes
| Drug resistance gene | ant(6)-Ia, erm(B), cat(pC233) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |