Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 107209 |
Name | oriT1_pT90-3 |
Organism | Enterococcus faecalis strain T90-3 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP069131 ( 60440..60477 [+], 38 nt) |
oriT length | 38 nt |
IRs (inverted repeats) | 14..22, 29..37 (TAAAGTATA..TATACTTTA) 2..8, 13..19 (ACTTTAT..ATAAAGT) |
Location of nic site | 27..28 |
Conserved sequence flanking the nic site |
GTGTGTTATA |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT1_pT90-3
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 7645 | GenBank | NZ_CP069131 |
Plasmid name | pT90-3 | Incompatibility group | - |
Plasmid size | 71139 bp | Coordinate of oriT [Strand] | 31919..31956 [-]; 60440..60477 [+] |
Host baterium | Enterococcus faecalis strain T90-3 |
Cargo genes
Drug resistance gene | fexB, poxtA, tet(L), tet(M), dfrG |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |