Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 107021 |
| Name | oriT_pCCK13698  |
| Organism | Bibersteinia trehalosi |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_007800 (508..643 [-], 136 nt) |
| oriT length | 136 nt |
| IRs (inverted repeats) | 15..20, 24..29 (CCCTAC..GTAGGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 136 nt
>oriT_pCCK13698
GTCAATGTGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GTCAATGTGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7457 | GenBank | NC_007800 |
| Plasmid name | pCCK13698 | Incompatibility group | - |
| Plasmid size | 14969 bp | Coordinate of oriT [Strand] | 508..643 [-] |
| Host baterium | Bibersteinia trehalosi |
Cargo genes
| Drug resistance gene | sul2, catA3, floR |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |