Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107021
Name   oriT_pCCK13698 in_silico
Organism   Bibersteinia trehalosi
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_007800 (508..643 [-], 136 nt)
oriT length   136 nt
IRs (inverted repeats)      15..20, 24..29  (CCCTAC..GTAGGG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 136 nt

>oriT_pCCK13698
GTCAATGTGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7457 GenBank   NC_007800
Plasmid name   pCCK13698 Incompatibility group   -
Plasmid size   14969 bp Coordinate of oriT [Strand]   508..643 [-]
Host baterium   Bibersteinia trehalosi

Cargo genes


Drug resistance gene   sul2, catA3, floR
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -