Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 107007 |
Name | oriT_p48293_Col |
Organism | Enterobacter hormaechei strain EC48293 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP070532 (3612..3671 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_p48293_Col
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 7444 | GenBank | NZ_CP070532 |
Plasmid name | p48293_Col | Incompatibility group | Col440I |
Plasmid size | 4096 bp | Coordinate of oriT [Strand] | 3612..3671 [+] |
Host baterium | Enterobacter hormaechei strain EC48293 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |