Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   107007
Name   oriT_p48293_Col in_silico
Organism   Enterobacter hormaechei strain EC48293
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP070532 (3612..3671 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p48293_Col
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7444 GenBank   NZ_CP070532
Plasmid name   p48293_Col Incompatibility group   Col440I
Plasmid size   4096 bp Coordinate of oriT [Strand]   3612..3671 [+]
Host baterium   Enterobacter hormaechei strain EC48293

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -