Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106980
Name   oriT_p54569CZ_IncQ1 in_silico
Organism   Enterobacter hormaechei strain 54569CZ
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP085762 (1844..2003 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_p54569CZ_IncQ1
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7417 GenBank   NZ_CP085762
Plasmid name   p54569CZ_IncQ1 Incompatibility group   IncQ1
Plasmid size   9402 bp Coordinate of oriT [Strand]   1844..2003 [-]
Host baterium   Enterobacter hormaechei strain 54569CZ

Cargo genes


Drug resistance gene   aph(3')-VIa
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -