Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106964
Name   oriT1_pMRSAKZN in_silico
Organism   Staphylococcus aureus strain KZN
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP060279 (15594..15833 [-], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 37..42, 45..50  (TTTTTT..AAAAAA)
 36..41, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT1_pMRSAKZN
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7401 GenBank   NZ_CP060279
Plasmid name   pMRSAKZN Incompatibility group   -
Plasmid size   46979 bp Coordinate of oriT [Strand]   15594..15833 [-]; 43236..43470 [+]
Host baterium   Staphylococcus aureus strain KZN

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   arsR, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21