Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106962 |
| Name | oriT_pSI111-2  |
| Organism | Salmonella enterica subsp. enterica serovar Indiana strain SI111 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP050766 (3382..3456 [+], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_pSI111-2
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7399 | GenBank | NZ_CP050766 |
| Plasmid name | pSI111-2 | Incompatibility group | ColRNAI |
| Plasmid size | 3916 bp | Coordinate of oriT [Strand] | 3382..3456 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Indiana strain SI111 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |