Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106958
Name   oriT_pSI102-5 in_silico
Organism   Salmonella enterica subsp. enterica serovar Indiana strain SI102
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP050776 (1491..1565 [-], 75 nt)
oriT length   75 nt
IRs (inverted repeats)      12..17, 20..25  (GCCCTG..CAGGGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pSI102-5
GTCGGGGCAAAGCCCTGACCAGGGCAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7395 GenBank   NZ_CP050776
Plasmid name   pSI102-5 Incompatibility group   ColRNAI
Plasmid size   2677 bp Coordinate of oriT [Strand]   1491..1565 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Indiana strain SI102

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -