Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106956
Name   oriT_pDsulf-L4 in_silico
Organism   Desulfovibrio desulfuricans strain L4
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP072609 (7658..7817 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pDsulf-L4
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7393 GenBank   NZ_CP072609
Plasmid name   pDsulf-L4 Incompatibility group   -
Plasmid size   10867 bp Coordinate of oriT [Strand]   7658..7817 [-]
Host baterium   Desulfovibrio desulfuricans strain L4

Cargo genes


Drug resistance gene   sul2, aph(3'')-Ib, aph(6)-Id, tet(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -