Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106922 |
| Name | oriT_pSH_1b_2  |
| Organism | Staphylococcus haemolyticus strain 1b |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP071514 (155..214 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pSH_1b_2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7359 | GenBank | NZ_CP071514 |
| Plasmid name | pSH_1b_2 | Incompatibility group | ColRNAI |
| Plasmid size | 5922 bp | Coordinate of oriT [Strand] | 155..214 [-] |
| Host baterium | Staphylococcus haemolyticus strain 1b |
Cargo genes
| Drug resistance gene | aph(3')-Ia |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |