Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106922
Name   oriT_pSH_1b_2 in_silico
Organism   Staphylococcus haemolyticus strain 1b
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP071514 (155..214 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pSH_1b_2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7359 GenBank   NZ_CP071514
Plasmid name   pSH_1b_2 Incompatibility group   ColRNAI
Plasmid size   5922 bp Coordinate of oriT [Strand]   155..214 [-]
Host baterium   Staphylococcus haemolyticus strain 1b

Cargo genes


Drug resistance gene   aph(3')-Ia
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -