Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106890
Name   oriT_pS3160_3 in_silico
Organism   Shigella flexneri strain 3160_NCHU22
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP094990 (2622..2909 [-], 288 nt)
oriT length   288 nt
IRs (inverted repeats)      249..254, 257..262  (CGCCCC..GGGGCG)
 130..138, 148..156  (GCGGTGTTG..CAACACCGC)
 31..38, 41..48  (GCAAAAAC..GTTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 288 nt

>oriT_pS3160_3
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAAAAAACATTATCTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7327 GenBank   NZ_CP094990
Plasmid name   pS3160_3 Incompatibility group   ColRNAI
Plasmid size   3182 bp Coordinate of oriT [Strand]   2622..2909 [-]
Host baterium   Shigella flexneri strain 3160_NCHU22

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -