Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106794 |
| Name | oriT_pCFA1707-3  |
| Organism | Citrobacter freundii strain CFA1707 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP110913 (69630..69734 [+], 105 nt) |
| oriT length | 105 nt |
| IRs (inverted repeats) | 56..61, 74..79 (TGGAAT..ATTCCA) 1..6, 8..13 (AATTTG..CAAATT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 105 nt
>oriT_pCFA1707-3
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAATATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAATATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7231 | GenBank | NZ_CP110913 |
| Plasmid name | pCFA1707-3 | Incompatibility group | IncA/C2 |
| Plasmid size | 70575 bp | Coordinate of oriT [Strand] | 69630..69734 [+] |
| Host baterium | Citrobacter freundii strain CFA1707 |
Cargo genes
| Drug resistance gene | blaNDM-1 |
| Virulence gene | htpB |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |