Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106774
Name   oriT_pR18.1078_p5.5k in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain R18.1078
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP065570 (1690..1749 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pR18.1078_p5.5k
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7211 GenBank   NZ_CP065570
Plasmid name   pR18.1078_p5.5k Incompatibility group   ColRNAI
Plasmid size   5570 bp Coordinate of oriT [Strand]   1690..1749 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain R18.1078

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -