Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106767
Name   oriT1_FDAARGOS_601|unnamed2 in_silico
Organism   Yersinia pestis strain FDAARGOS_601
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP033698 ( 902..961 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT1_FDAARGOS_601|unnamed2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7204 GenBank   NZ_CP033698
Plasmid name   FDAARGOS_601|unnamed2 Incompatibility group   ColRNAI
Plasmid size   19216 bp Coordinate of oriT [Strand]   10511..10570 [-]; 902..961 [-]
Host baterium   Yersinia pestis strain FDAARGOS_601

Cargo genes


Drug resistance gene   -
Virulence gene   pla
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -