Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106761 |
| Name | oriT_Effluent_1|unnamed2  |
| Organism | Citrobacter portucalensis strain Effluent_1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP039329 (13476..13760 [+], 285 nt) |
| oriT length | 285 nt |
| IRs (inverted repeats) | 184..189, 191..196 (AAAAGT..ACTTTT) |
| Location of nic site | 109..110 |
| Conserved sequence flanking the nic site |
TTTGGTTAAA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 285 nt
>oriT_Effluent_1|unnamed2
GGTTATTGCTACTTAATGCCGATAACGACTCAGGCTTTGAGGTTTTTTTATACGGTTCACATTTCGTTAGCAAGGTCAGGGTTTTTTGATAAAATTCTGGTTAGTTTGGTTAAAAAGTGTTACAAGTATGGGTAATGGCTGAAAGGTTAGTTTTAAGGTTCAAAGCGGCAGTATTAAAATTCCAAAAGTTACTTTTCATCCTTCAGAATCCAGACCTTAATTTCATGTAGAAGATTCGTACAATTGTATTGGCGCAAGGACAATCCGCACATGTCAGAATCAGAT
GGTTATTGCTACTTAATGCCGATAACGACTCAGGCTTTGAGGTTTTTTTATACGGTTCACATTTCGTTAGCAAGGTCAGGGTTTTTTGATAAAATTCTGGTTAGTTTGGTTAAAAAGTGTTACAAGTATGGGTAATGGCTGAAAGGTTAGTTTTAAGGTTCAAAGCGGCAGTATTAAAATTCCAAAAGTTACTTTTCATCCTTCAGAATCCAGACCTTAATTTCATGTAGAAGATTCGTACAATTGTATTGGCGCAAGGACAATCCGCACATGTCAGAATCAGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7198 | GenBank | NZ_CP039329 |
| Plasmid name | Effluent_1|unnamed2 | Incompatibility group | IncFIB |
| Plasmid size | 66363 bp | Coordinate of oriT [Strand] | 13476..13760 [+] |
| Host baterium | Citrobacter portucalensis strain Effluent_1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |