Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 106748 |
Name | oriT_pC101MK3 |
Organism | Staphylococcus epidermidis strain C101 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP094875 (3892..4011 [+], 120 nt) |
oriT length | 120 nt |
IRs (inverted repeats) | 52..58, 62..68 (TTGGGGA..TCCCCAA) 23..30, 34..41 (ATTTTTTC..GAAAAAAT) 1..8, 14..21 (AGTGGCTA..TAGCCACT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 120 nt
>oriT_pC101MK3
AGTGGCTAGCAATTAGCCACTTATTTTTTCGCAGAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTGAGTGGCTAGCAAAGCCAATGCTTGCCAAA
AGTGGCTAGCAATTAGCCACTTATTTTTTCGCAGAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTGAGTGGCTAGCAAAGCCAATGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 7185 | GenBank | NZ_CP094875 |
Plasmid name | pC101MK3 | Incompatibility group | - |
Plasmid size | 6737 bp | Coordinate of oriT [Strand] | 3892..4011 [+] |
Host baterium | Staphylococcus epidermidis strain C101 |
Cargo genes
Drug resistance gene | vga(A)LC |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |