Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106746
Name   oriT_pC99MK3 in_silico
Organism   Staphylococcus epidermidis strain C99
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP094862 (3892..4011 [+], 120 nt)
oriT length   120 nt
IRs (inverted repeats)      52..58, 62..68  (TTGGGGA..TCCCCAA)
 23..30, 34..41  (ATTTTTTC..GAAAAAAT)
 1..8, 14..21  (AGTGGCTA..TAGCCACT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 120 nt

>oriT_pC99MK3
AGTGGCTAGCAATTAGCCACTTATTTTTTCGCAGAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTGAGTGGCTAGCAAAGCCAATGCTTGCCAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7183 GenBank   NZ_CP094862
Plasmid name   pC99MK3 Incompatibility group   -
Plasmid size   6737 bp Coordinate of oriT [Strand]   3892..4011 [+]
Host baterium   Staphylococcus epidermidis strain C99

Cargo genes


Drug resistance gene   vga(A)LC
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -