Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106745 |
| Name | oriT_pC100MK3  |
| Organism | Staphylococcus epidermidis strain C100 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP094868 (3892..4011 [+], 120 nt) |
| oriT length | 120 nt |
| IRs (inverted repeats) | 52..58, 62..68 (TTGGGGA..TCCCCAA) 23..30, 34..41 (ATTTTTTC..GAAAAAAT) 1..8, 14..21 (AGTGGCTA..TAGCCACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 120 nt
>oriT_pC100MK3
AGTGGCTAGCAATTAGCCACTTATTTTTTCGCAGAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTGAGTGGCTAGCAAAGCCAATGCTTGCCAAA
AGTGGCTAGCAATTAGCCACTTATTTTTTCGCAGAAAAAATCCTAAGGGGCTTGGGGATATTCCCCAACAAGCAGGCGTCGCTACCACGTGAGTGGCTAGCAAAGCCAATGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7182 | GenBank | NZ_CP094868 |
| Plasmid name | pC100MK3 | Incompatibility group | - |
| Plasmid size | 6736 bp | Coordinate of oriT [Strand] | 3892..4011 [+] |
| Host baterium | Staphylococcus epidermidis strain C100 |
Cargo genes
| Drug resistance gene | vga(A)LC |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |