Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106743
Name   oriT1_pATCC29213 in_silico
Organism   Staphylococcus aureus strain ATCC 29213
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP094858 (44851..45090 [-], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 37..42, 45..50  (TTTTTT..AAAAAA)
 36..41, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT1_pATCC29213
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7180 GenBank   NZ_CP094858
Plasmid name   pATCC29213 Incompatibility group   -
Plasmid size   46979 bp Coordinate of oriT [Strand]   44851..45090 [-]; 25514..25748 [+]
Host baterium   Staphylococcus aureus strain ATCC 29213

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   arsR, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21