Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106742
Name   oriT_VRE3355|unnamed2 in_silico
Organism   Enterococcus faecium strain VRE3355
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP071929 (11706..11882 [-], 177 nt)
oriT length   177 nt
IRs (inverted repeats)      91..97, 107..113  (ATTTTTT..AAAAAAT)
 92..98, 105..111  (TTTTTTG..CAAAAAA)
 28..34, 37..43  (CCTTCCT..AGGAAGG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 177 nt

>oriT_VRE3355|unnamed2
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGCGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7179 GenBank   NZ_CP071929
Plasmid name   VRE3355|unnamed2 Incompatibility group   -
Plasmid size   24233 bp Coordinate of oriT [Strand]   11706..11882 [-]
Host baterium   Enterococcus faecium strain VRE3355

Cargo genes


Drug resistance gene   erm(B)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -