Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106723 |
| Name | oriT_pM-3471_DHA  |
| Organism | Salmonella enterica subsp. enterica serovar Anatum strain M-3471 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP045459 (87639..87743 [-], 105 nt) |
| oriT length | 105 nt |
| IRs (inverted repeats) | 56..61, 74..79 (TGGAAT..ATTCCA) 46..51, 56..61 (ATTCCA..TGGAAT) 1..6, 8..13 (AATTTG..CAAATT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 105 nt
>oriT_pM-3471_DHA
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7160 | GenBank | NZ_CP045459 |
| Plasmid name | pM-3471_DHA | Incompatibility group | IncA/C2 |
| Plasmid size | 89619 bp | Coordinate of oriT [Strand] | 87639..87743 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Anatum strain M-3471 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |