Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106716 |
| Name | oriT_pR18.0877_3.3k  |
| Organism | Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP037958 (2288..2348 [+], 61 nt) |
| oriT length | 61 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 61 nt
>oriT_pR18.0877_3.3k
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7153 | GenBank | NZ_CP037958 |
| Plasmid name | pR18.0877_3.3k | Incompatibility group | - |
| Plasmid size | 3373 bp | Coordinate of oriT [Strand] | 2288..2348 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |