Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106669 |
| Name | oriT_plas1  |
| Organism | Streptococcus equinus strain SheepZ001 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP075173 (2524..2578 [+], 55 nt) |
| oriT length | 55 nt |
| IRs (inverted repeats) | 16..23, 27..34 (ATATCACG..CGTGATAT) 1..7, 9..15 (GTTGATA..TATCAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 55 nt
>oriT_plas1
GTTGATACTATCAACATATCACGGCACGTGATATCAGTTTCCCTTATGCTCTTTT
GTTGATACTATCAACATATCACGGCACGTGATATCAGTTTCCCTTATGCTCTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7106 | GenBank | NZ_CP075173 |
| Plasmid name | plas1 | Incompatibility group | - |
| Plasmid size | 4851 bp | Coordinate of oriT [Strand] | 2524..2578 [+] |
| Host baterium | Streptococcus equinus strain SheepZ001 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |