Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106646
Name   oriT_RHB02-E4-C07|unnamed4 in_silico
Organism   Escherichia marmotae strain RHB02-E4-C07
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099355 (3586..3660 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_RHB02-E4-C07|unnamed4
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7083 GenBank   NZ_CP099355
Plasmid name   RHB02-E4-C07|unnamed4 Incompatibility group   ColRNAI
Plasmid size   4148 bp Coordinate of oriT [Strand]   3586..3660 [+]
Host baterium   Escherichia marmotae strain RHB02-E4-C07

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -