Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106644
Name   oriT_RHB02-E4-C07|unnamed3 in_silico
Organism   Escherichia marmotae strain RHB02-E4-C07
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099354 (1588..1647 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_RHB02-E4-C07|unnamed3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7081 GenBank   NZ_CP099354
Plasmid name   RHB02-E4-C07|unnamed3 Incompatibility group   ColRNAI
Plasmid size   8401 bp Coordinate of oriT [Strand]   1588..1647 [+]
Host baterium   Escherichia marmotae strain RHB02-E4-C07

Cargo genes


Drug resistance gene   sul2, aph(3'')-Ib, aph(6)-Id, tet(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -