Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106643
Name   oriT_RHB02-E4-C07|unnamed1 in_silico
Organism   Escherichia marmotae strain RHB02-E4-C07
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099352 (47034..47317 [-], 284 nt)
oriT length   284 nt
IRs (inverted repeats)      183..188, 190..195  (AAAAGT..ACTTTT)
 45..50, 55..60  (TTTTAA..TTAAAA)
Location of nic site      108..109
Conserved sequence flanking the
  nic site  
 
 TTTGGTTAAA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 284 nt

>oriT_RHB02-E4-C07|unnamed1
GTTATTGCCGCTTAATGCCGATAACGATTCGGGCTTTGCTATTTTTTTAAGCGATTAAAATTTCGTTAGCAAGCGCAGGGTTTTTTGATAAAATTCTGGTTAGTTTGGTTAAAAAGTGTTACAAGTAAGGCCAATGGATGAATGGTTAGTTTTAAGACTCAAATAGGCAGTATTAAAATTCCAAAAGTTACTTTTCATCATTCAAAAACCAAACTTTAATTTCATGTAGAAGATTAGTGCAATTGTATTGACGCAAGGACAATCCGCACATGTCAGAATCAGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7080 GenBank   NZ_CP099352
Plasmid name   RHB02-E4-C07|unnamed1 Incompatibility group   IncY
Plasmid size   116771 bp Coordinate of oriT [Strand]   47034..47317 [-]
Host baterium   Escherichia marmotae strain RHB02-E4-C07

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   terW, terZ, terA, terB, terC, terD, terE
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -