Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106642 |
| Name | oriT_RHB08-SO-C04|unnamed5  |
| Organism | Klebsiella aerogenes strain RHB08-SO-C04 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP099265 (226..270 [-], 45 nt) |
| oriT length | 45 nt |
| IRs (inverted repeats) | 7..13, 25..31 (CGTTTCT..AGAAACG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 45 nt
>oriT_RHB08-SO-C04|unnamed5
GCGCACCGTTTCTGAACGAAGTGAAGAAACGTCTAAGTGCGCCCT
GCGCACCGTTTCTGAACGAAGTGAAGAAACGTCTAAGTGCGCCCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7079 | GenBank | NZ_CP099265 |
| Plasmid name | RHB08-SO-C04|unnamed5 | Incompatibility group | - |
| Plasmid size | 1951 bp | Coordinate of oriT [Strand] | 226..270 [-] |
| Host baterium | Klebsiella aerogenes strain RHB08-SO-C04 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |