Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106641
Name   oriT_RHB08-SO-C04|unnamed4 in_silico
Organism   Klebsiella aerogenes strain RHB08-SO-C04
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099264 (3151..3208 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_RHB08-SO-C04|unnamed4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGGAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7078 GenBank   NZ_CP099264
Plasmid name   RHB08-SO-C04|unnamed4 Incompatibility group   Col440II
Plasmid size   4215 bp Coordinate of oriT [Strand]   3151..3208 [+]
Host baterium   Klebsiella aerogenes strain RHB08-SO-C04

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -