Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106638
Name   oriT_RHB44-C01|unnamed5 in_silico
Organism   Escherichia fergusonii strain RHB44-C01
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099343 (1068..1167 [+], 100 nt)
oriT length   100 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 100 nt

>oriT_RHB44-C01|unnamed5
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7075 GenBank   NZ_CP099343
Plasmid name   RHB44-C01|unnamed5 Incompatibility group   Col
Plasmid size   1549 bp Coordinate of oriT [Strand]   1068..1167 [+]
Host baterium   Escherichia fergusonii strain RHB44-C01

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -