Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106632
Name   oriT_RHB02-E1-C03|unnamed4 in_silico
Organism   Escherichia fergusonii strain RHB02-E1-C03
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099362 (3179..3238 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_RHB02-E1-C03|unnamed4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7069 GenBank   NZ_CP099362
Plasmid name   RHB02-E1-C03|unnamed4 Incompatibility group   Col440II
Plasmid size   4664 bp Coordinate of oriT [Strand]   3179..3238 [+]
Host baterium   Escherichia fergusonii strain RHB02-E1-C03

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -