Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106631
Name   oriT_RHB02-E1-C03|unnamed3 in_silico
Organism   Escherichia fergusonii strain RHB02-E1-C03
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099361 (3196..3478 [-], 283 nt)
oriT length   283 nt
IRs (inverted repeats)      130..138, 148..156  (GCGGTGTTG..CAACACCGC)
 31..38, 41..48  (GCAAAAAC..GTTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 283 nt

>oriT_RHB02-E1-C03|unnamed3
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATCTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGATGCCCCTGGGGGCGCTGCTAGGGGTGTCTATTCAGATAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7068 GenBank   NZ_CP099361
Plasmid name   RHB02-E1-C03|unnamed3 Incompatibility group   ColRNAI
Plasmid size   5264 bp Coordinate of oriT [Strand]   3196..3478 [-]
Host baterium   Escherichia fergusonii strain RHB02-E1-C03

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -