Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106629
Name   oriT_RHB11-E1-C08|unnamed1 in_silico
Organism   Klebsiella aerogenes strain RHB11-E1-C08
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099253 (1880..1929 [-], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      6..12, 15..21  (CAAAATT..AATTTTG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_RHB11-E1-C08|unnamed1
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGATATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7066 GenBank   NZ_CP099253
Plasmid name   RHB11-E1-C08|unnamed1 Incompatibility group   Col440I
Plasmid size   3960 bp Coordinate of oriT [Strand]   1880..1929 [-]
Host baterium   Klebsiella aerogenes strain RHB11-E1-C08

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -