Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106627
Name   oriT_RHB45-SO-C02|unnamed4 in_silico
Organism   Enterobacter hormaechei strain RHB45-SO-C02
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099322 (1801..1860 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_RHB45-SO-C02|unnamed4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7064 GenBank   NZ_CP099322
Plasmid name   RHB45-SO-C02|unnamed4 Incompatibility group   -
Plasmid size   3428 bp Coordinate of oriT [Strand]   1801..1860 [+]
Host baterium   Enterobacter hormaechei strain RHB45-SO-C02

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -