Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106619 |
| Name | oriT_SRCM103448|unnamed3 |
| Organism | Weissella cibaria strain SRCM103448 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP035270 (4188..4224 [-], 37 nt) |
| oriT length | 37 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 37 nt
>oriT_SRCM103448|unnamed3
ACATCACCCAATATTGGGTGATGTGTAAGTGCACATT
ACATCACCCAATATTGGGTGATGTGTAAGTGCACATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7056 | GenBank | NZ_CP035270 |
| Plasmid name | SRCM103448|unnamed3 | Incompatibility group | - |
| Plasmid size | 6523 bp | Coordinate of oriT [Strand] | 4188..4224 [-] |
| Host baterium | Weissella cibaria strain SRCM103448 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |