Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106612 |
| Name | oriT1_pDSM20484  |
| Organism | Leuconostoc mesenteroides subsp. dextranicum strain DSM 20484 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP012010 ( 9116..9151 [-], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 1..6, 17..22 (CACCAC..GTGGTG) |
| Location of nic site | 18..19 |
| Conserved sequence flanking the nic site |
TGTGTGGTGT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT1_pDSM20484
CACCACCAATTTATGTGTGGTGTGTAAGTGCGCATT
CACCACCAATTTATGTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 7049 | GenBank | NZ_CP012010 |
| Plasmid name | pDSM20484 | Incompatibility group | - |
| Plasmid size | 36094 bp | Coordinate of oriT [Strand] | 26051..26086 [-]; 9116..9151 [-] |
| Host baterium | Leuconostoc mesenteroides subsp. dextranicum strain DSM 20484 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |