Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106608
Name   oriT_pST3606-5 in_silico
Organism   Salmonella enterica subsp. enterica strain 3018683606
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP094337 (1063..1137 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pST3606-5
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   7045 GenBank   NZ_CP094337
Plasmid name   pST3606-5 Incompatibility group   ColRNAI
Plasmid size   3001 bp Coordinate of oriT [Strand]   1063..1137 [+]
Host baterium   Salmonella enterica subsp. enterica strain 3018683606

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -