Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106482
Name   oriT1_p2021-16354-2 in_silico
Organism   Staphylococcus aureus strain WA121-2021_16354
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP093937 (20510..20749 [-], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 37..42, 45..50  (TTTTTT..AAAAAA)
 36..41, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT1_p2021-16354-2
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6919 GenBank   NZ_CP093937
Plasmid name   p2021-16354-2 Incompatibility group   -
Plasmid size   34986 bp Coordinate of oriT [Strand]   20510..20749 [-]; 1177..1411 [+]
Host baterium   Staphylococcus aureus strain WA121-2021_16354

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsR, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21