Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106480
Name   oriT1_p2010-15611-2 in_silico
Organism   Staphylococcus aureus strain WA121-2010_15611
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP093932 (20514..20753 [-], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 37..42, 45..50  (TTTTTT..AAAAAA)
 36..41, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT1_p2010-15611-2
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6917 GenBank   NZ_CP093932
Plasmid name   p2010-15611-2 Incompatibility group   -
Plasmid size   34990 bp Coordinate of oriT [Strand]   20514..20753 [-]; 1177..1411 [+]
Host baterium   Staphylococcus aureus strain WA121-2010_15611

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsR, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21