Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106478
Name   oriT1_p2021-15363 in_silico
Organism   Staphylococcus aureus strain WA121-2021_15363
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP093934 (20514..20753 [-], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 37..42, 45..50  (TTTTTT..AAAAAA)
 36..41, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT1_p2021-15363
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6915 GenBank   NZ_CP093934
Plasmid name   p2021-15363 Incompatibility group   -
Plasmid size   34990 bp Coordinate of oriT [Strand]   20514..20753 [-]; 1177..1411 [+]
Host baterium   Staphylococcus aureus strain WA121-2021_15363

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsR, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21