Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   106429
Name   oriT_pK21EFM001_1_4 in_silico
Organism   Enterococcus faecium strain V13-21-E11-012-001
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP092375 (17359..17535 [+], 177 nt)
oriT length   177 nt
IRs (inverted repeats)      91..97, 107..113  (ATTTTTT..AAAAAAT)
 92..98, 105..111  (TTTTTTG..CAAAAAA)
 26..34, 37..45  (CACCTTCCT..AGGAAGGTG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 177 nt

>oriT_pK21EFM001_1_4
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGTGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6866 GenBank   NZ_CP092375
Plasmid name   pK21EFM001_1_4 Incompatibility group   -
Plasmid size   44886 bp Coordinate of oriT [Strand]   17359..17535 [+]
Host baterium   Enterococcus faecium strain V13-21-E11-012-001

Cargo genes


Drug resistance gene   aph(3')-III, erm(B), VanHAX
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -