Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 106428 |
| Name | oriT_pB26H  |
| Organism | Lactococcus cremoris strain B26 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP032443 (1059..1094 [+], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_pB26H
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6865 | GenBank | NZ_CP032443 |
| Plasmid name | pB26H | Incompatibility group | - |
| Plasmid size | 2065 bp | Coordinate of oriT [Strand] | 1059..1094 [+] |
| Host baterium | Lactococcus cremoris strain B26 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |